denacharles0 denacharles0

Today at 8:17 PM
Mathematics

Answered

if it's 4:25 what time will it be in 3 hours and 20 minutes

Answer :

MatthewHargreaves MatthewHargreaves

Today at 8:22 PM

Answer:

7:45

Step-by-step explanation:

Answer Link

Intsaam Intsaam

Today at 8:22 PM

Answer:

if it's 4:25 in 3h and 20 min the time will be 7:45

Answer Link

Other Questions

Determine the standard form of the equation of the line that passes through (-6, 6) and (3, -2). A. -8x + 9y = -6 C. -8x -9y = 6 B. 8x + 9y = 6 D. 9x - 8y = 6

Determine the standard form of the equation of the line that passes through (-6, 6) and (3, -2). A. -8x + 9y = -6 C. -8x -9y = 6 B. 8x + 9y = 6 D. 9x - 8y = 6

Im really confused and select all that apply questions scare me.

which one represents translation

From Scenario 1: What is the Experimental group? O the color change O the type of bush O the type of soil O the type of fertlizer

How does water help a plant to keep cool

क्लास टेंथ द प्रपोजल चैप्टर क्वेश्चन राइट द प्रपोजल सूटेबल टाइटल फॉर द चैप्टर और नॉट राइट द डिफरेंस

26. Why did the fawn make no efforts to rise?(This is Jody's Fawn) *(1 Point)Because it was weak.Because it was very small.Because it was unwell.

how long will it take to travel 912 km?

Present ages of saika and amir are in the ratio 4:5. eight years from now the ratio of their ages will be 5:6. find their present ages.

How many moles of barium sulfate are produced from 0.100 mole of barium chloride?

Presented below is the partial bond discount amortization schedule for Cullumber Corp. Cullumber uses the effective-interest method of amortization. Interest Pe

Which of the following is not a good example of a marketing-related key success factor? A. a well-known and well-respected brand name B. breadth of product line

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCA

Draw the product of the reaction between CH3CH=CHCH3 and H2 under a platinum catalyst.

On a given day, the discount rate is 3.65%, the prime rate is 3.55%, the LIBOR is 3.30%, the federal funds rate is 3.25%, and the federal funds target rate is 3

Vitamin C ascorbic acid (C6F1806), is a reducing agent. One way to determine the ascorbic acid content of a sample is to mix the acid with an excess of iodine C

The owner of Maumee Ford-Volvo wants to study the relationship between the age of a car and its selling price. Listed below is a random sample of 12 used cars s

Suppose that the marginal cost of mining gold is constant at $300 per ounce and the demand schedule is as follows: PRICE (per oz.) QUANTITY (per oz.) $1000 1000

Hudson Corporation will pay a dividend of $5.00 per share next year. The company pledges to increase its dividend by 7.80 percent per year indefinitely. If you