stuealvarez01 stuealvarez01

Today at 11:21 AM
Mathematics

Answered

No solution
5-4+7x+1= ?x+?
one solution
5-4+7x+1= ?x+?
many solutions
5-4+7x+1= ?x+?

What would the question marks be ?

Answer :

Jos11herz Jos11herz

Today at 11:26 AM

Answer:

7x

Step-by-step explanation:

Answer Link

Other Questions

Looo at each algebraic expression and then write a phrase for that expression in the blue box.

Can you please help me please please thank you very much you please

Meghan found 15 pieces of sea glass on the beach the next day she found four more pieces then she found the day before write and solve an equation to find how m

2. A movie projector positioned 54 feet from a wall creates an image that 9 feet wide on the wall. If a screen is placed 27 feet in front of the projector,what

Meghan found 15 pieces of sea glass on the beach the next day she found four more pieces then she found the day before write and solve an equation to find how m

Q4.(a) What were the reasons and events of the conquest of Makkah [7]

is write in examination papers. They do not

the important movements of India name them

Make a project report on topic equations of motion

Use the possessive form of nouns in place of the bracket phrase in the sentences below . The first one has been done as an example .1.Avinash hurled ( the book

Please help me with this question: The image has been included Sherry recorded how many miles she ran each day in the table.

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts): Amino acid ( 3pts):

Julio had 1000 sq. ft. of living space. Then he added a room that was 20 ft. by 10 ft. TO What was the fractional increase of living space? 1 OA OB. OC. . 1 5 O

Which of the following is one of Dalton's postulates? A. An object in motion stays in motion unless acted upon by an outside force. B. For every action there is

The commercial jet that travels from Miami to New York averages about 300 mi/h. The air distance fromMiami to New York is 1092 miles. Write a function to repres

Stuck pls helpshow ur steps2/3

A 0.5-kg ball accelerated at 50 m/s2. What force was applied?

Can someone help me with this? A man purchased a used car for $1000. He decided t sell the car for 40% above his purchase price. He could not sell the car so he

A shipping container is in the form of a right rectangular prism, with dimensions of 30 ft by 8 ft by 8 ft 3 in. If the container holds 1426 cubic feet of shipp

1,000 at 7 3\4 % for 4 years.