sulyoscaroxbkzr
sulyoscaroxbkzr
Today at 3:15 AM
Mathematics
Answered
help please and thank youu
Answer :
26hessl
26hessl
Today at 3:20 AM
Answer:
c
Step-by-step explanation:
number number number number
Answer Link
VIEW ALL ANSWERS ( 94+ )
Other Questions
suppose that rosa's favorite is sausage and onion, but her mom can't remember that, and she is going to randomly choose 222 different toppings. what is the prob
Why gandhiji decided to launch anationwide satyagraha in 1919?
class 7th English solution of workbbok
in ∆ABC,DE||BC ,find X
What city was the first capital of the United States? @zhibakc pls answer this
Design a knuckle Joint to connect two rod with axial pull of lookN, a material of Joint is 45C, Syt = 380 N/mm². and take Factor of Safety = 2.5
the confidence interval for the mean of y is always narrower than the prediction interval for an individual response y given the same data set, x value, and con
waleed just got a new smart cell phone. he did his research before purchasing the phone since he needed it for work purposes. which information source is an exa
All marsupials except one group exist on the continent a. asia. b. africa. c. australia. d. north america.
the price of milk at the local grocery store is cut by 25%. in response to this price cut, the quantity of milk demanded increases by 10%. what is the absolute
if you wanted to link a new ads account to your analytics property in order to see detailed marketing campaign data, where in your analytics 4 property would yo
what is the current i(t) in the circuit at time t after the switch is closed? express your answer in terms of q0 , l , c , and other variables given in the intr
two objects are thrown from the top of a tall building. one is thrown up, and the other is thrown down, both with the same initial speed. what are their speeds
if a polymorphic pointer is used to access a new member of a derived class (a member that does not exist in the base class), what will happen?
our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha
hat is the average i/o time to transfer a 16kb block on a 4800 rpm disk with a 5ms average seek time, 2gb/sec transfer rate with a .2ms controller overhead? (wr
