ruby4149 ruby4149

Today at 8:15 PM
Spanish

Answered

A ellos les _____ las clases de español.

gusta
gustan

Answer :

bryantmalayah08 bryantmalayah08

Today at 8:20 PM

Gustan is the correct answer

Answer Link

2vwdghad8h 2vwdghad8h

Today at 8:20 PM

A ellos les gustan las clases de espanol, because for gusta it would be a mi me gusta las clases de espanol

Answer Link

Other Questions

Find an equation of the line having the given slope and passing through the given point Slope -9 through (-8,-9)

Write a two variable equation to represent how many miles Eman can walk over any time interval. Use x as your variable.

Given the following data set: 90, 92, 90, 91, 92, 90, 93, 95, 98 What is the mean? 91.9 92 OOO 92.3 92.6

Use the table, along with dimensional analysis, to convert the given square unit to the square unit indicated.

Classify the four angles of the quadrilateral. B LA 60° C с ZB В 1409 LC 90° 700

brazil and argentia of south america are more developed than other countries. write any four reason behind it

చదువు రాకపోతే ఏయే కష్టాలు కలుగుతాయో ఊహించి రాయండి.పంపిణీ2020-21

What is the default value of one notch scroll ?REQUEST:I know the answer of google but it is incorrect so please don't search it in google

i will exercise in GYM three times a week which part of SMART is missing?

5 N force produce an acceleration of 10 ms-2 on an object.what is it's mass

Enter the correct answer in the box. Use the difference of cubes identity to write the expression x³ - 64 in factored form.

101 16 Drag the tiles to the correct boxes to complete the pairs. Which type of figurative language matches each sentence? The book's popularity spread like wil

What is the equation for the nth term of the arithmetic sequence where a1 = 28 and d = –6?

A jacket's original price is 65.00 dollars. It is on sale for 40% off. U have to pay 5% sales tax. What is the final price for the jacket ?

Transcribe and translate the following DNA sequence: GCCCTACGTCACCAGGCTGATTC I can’t find the AUG

Which of the following are solutions to the equation? 3x-4y-8 =12 Select all that apply.

Iron and Steel carries a $564,800 inventory. The company estimates the annual cost of carrying the inventory at 27 percent of the value of the inventory.

A math team is working through a set of puzzles. The following diagram describes the numbers of puzzles they've started and not yet started. A tape diagram with

A group of friends wants to go to the amusement park. They have no more than $190 to spend on parking and admission. Parking is $7, and tickets cost $15.25 per

Which bond is most polar? F-F, F-CI, F-Br, F-I