dianaquique00 dianaquique00

Today at 6:57 PM
English

Answered

It’s important to __________ a good impression when you travel abroad.

Answer :

possibility568 possibility568

Today at 7:02 PM

make

because you dont want foreign countries to think poorly of your country and reject future tourism and such

Answer Link

Other Questions

what does it mean physically when the amount of incident light is equal to the amount of transmitted light? is the light being absorbed or transmitted?

collins, a researcher, conducts an experiment and then informs his participants about the purpose of his study, the results expected, and the practical implicat

41.3% complete question a small organization operates several virtual servers in a single host environment. the physical network utilizes a physical firewall wi

a 4 mc charge has velocity u 5 1.4ax 2 3.2ay 2 az m/s at point p(2, 5, 23) in the presence of e 5 2xyzax 1 x2zay 1 x2yaz v/m and b 5 y2ax 1 z2ay 1 x2az wb/m2. f

a 4 mc charge has velocity u 5 1.4ax 2 3.2ay 2 az m/s at point p(2, 5, 23) in the presence of e 5 2xyzax 1 x2zay 1 x2yaz v/m and b 5 y2ax 1 z2ay 1 x2az wb/m2. f

Question A body has -10C of charge, If 3\times10^{20} electrons are removed from this, then find new charge on the body

पर्यावरण का अध्ययन जीव-विज्ञान की किस शाखा के अन्तर्गत किया जाता है ?(A) वर्गिक(B) आनुवंशिकी(C) कार्यिकी(D) पारिस्थितिकीbest h apki bhabhi xD hahaha

describe any 3 features of vienna treaty1815

he invented fire short aans

Horace Danby was a meticulous planner but still he faltered. Wheredid he go wrong and why?

The mRNA produced by the transcription of a gene encoding an oligopeptide is: 5 'AAAUGAAACCAGGAUAAGAAUU3' while the peptide produced by the translation of the a

a line with a slope of 9 passes through the point ( 1, 7). what is its equation in slope-intercept form?

3.14159265359 4.5+is rational because it is a terminating decimal. irrational because it is a repeating decimal. irrational because it is a non-terminating and

Problem Statement Stacey wants to build a bookshelf for her office, so she goes online and finds a plan for a bookshelf that she really likes. When she begins t

A/An is described as a piece of metal that acts as a safety device in a circuit which melts and stops the current.circuit breakerfuseground fault interruptersho

Based on the Census, state A has 12 fewer electoral votes for President than state B. If the total number of electoral votes for these two states is 82, find th

What is 5/6 - 3/8? Chose the answer in the most simplified form. A. 1/3 B. 9/16 C. 1/12 D. 11/24

Graph the line described by the equation y = -x+2

What is the value of f(-1) when f(x) = 2x + 2? Enter your answer in the box. f(-1)=???

List and explain three ways that biodiversity is important.