shh7849 shh7849

Today at 2:09 PM
Physics

Answered

Which of the following is TRUE about thermal equilibrium?

Which of the following is TRUE about thermal equilibrium? class=

Answer :

alexcotb20 alexcotb20

Today at 2:15 PM

Answer:

option one

Explanation:

equilibrium is used to describe the point in which something meets in this case the temperature of an object

Answer Link

Other Questions

A horizontal tube of non-uniform cross-section has radii of 0.1 m and 0.05 m, respectively, at M and N. For a streamline flow of liquid, the rate of liquid flow

The current through a silicon diode when biased with forward voltage with 4V, at temperature is 2mA, then diode dynamic resistance is.

A wire 2 m long and 2 mm in diameter, when stretched by a weight of 8 kg, has its length increases by 0.24 mm. Find the stress, strain, and Young's modulus of t

A patient suffering from ADA deficiency can be permanently cured using how many of the given treatments?

A geyser heats water flowing at the rate of 3L per minute from 27°C to 77°C. Operating on a gas burner, what is the rate of combustion of fuel, considering its

What is the function of ATP molecules?

write a short note on,"magnetic compass"

emperor become a Buddhist and helped spread the religion

What is haemodialysis????????

Tims brother is 5 years old use possesive nouns

c) Cecilia vende productos por internet y para consolidar su negocio cuida mucho la calidad de su servicio. Como una estrategia, registra los tiempos de entrega

4 acciones concretas que indiquen tu vivir como misionero y disipulo de jesucristo

Con un coeficiente de fricción estático de 0.5, el ángulo necesario para que comience a deslizarse la caja de madera, es aproximadamente?

- Una ventana abarca un área de 4 m², ¿cuál es el área que abar cm²? A) 40 B) 400 C) 4,000 D) 40,000

Imagine a sphere. if the sphere is cut three times at right angles, the resulting pieces would be what fraction of the original sphere?

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

Explain the invisible-hand argument. In your response, be sure to explain why this argument is a utilitarian argument for capitalism. What are some of the argum

Daryna is the manager of a company that sells and services home generators. She has noticed tha the demand for generators dropped significantly this spring. She

Select the correct Definite article for the noun given. "Arbol" la unas un el

A 1.4 kg block on a horizontal surface is pulled by a horizontal applied force. It takes 5.5 N to start the block moving and 4.1 N to keep it moving at a consta