keilonmcalester49 keilonmcalester49

Today at 6:22 PM
English

Answered

What is a difference between patronize and condescend?

Answer :

aaliyahmontague150 aaliyahmontague150

Today at 6:27 PM

Answer:

Condescending is showing the attitude that others are inferior whereas patronizing is treating with an apparent kindness which betrays a feeling of superiority. This is the main difference between condescending and patronizing

Explanation:

just look it up :)

Answer Link

Other Questions

Which element has a molar of 15.99 g/mol?

Which element has a molar of 15.99 g/mol?

How might increasing trade with China and the Middle East have impacted medieval society?

1) François 1er est né à Paris. True False 2) Hier, ..... à l'école. j'ai conduit je conduis je conduise je conduire 3) Il faut trouver une usine pour garer la

Which element has a molar of 15.99 g/mol?

6 gm of koh is dissloved in 1l of a solution . Find its ph .

How was the system of estates in french society organized ? Who constitued middle class ? Whay were their ideas about privileges in society ?

Fill in the blanks:1) 11.0 11÷ 11 is equal to2) Integers are not closed under3) A fraction when divided by itself gives4) -10 x 0 is equal to5) The reciprocal o

What will be the angle of reflection whenangle of incidence isi) 60°i) 0°

How Did You Spend Your Summer Vacation Essay

On January 16, 1917, in a clear attempt to convince the Mexican government to help Germany in the war, Arthur Zimmermann, the German foreign secretary, sent a t

Luis set a glass of water outside in the sunshine. When he looked at the glass ten minutes later, the contents had changed. what kind of change happened to the

In terms of gender differences in mental ability, research indicates that

Find m/P A.30 B.80 C.150 D.330

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

A small company’s net income for the first six months of the year was 76,500 and for the last six months it was 100,000. What is the ratio of the first six mont

Can someone make me a poem about racism

LMN is s right triangle. A. True B. False

The ratio of rock songs to dance songs on Jonathan's MP3 player is 5:6. If Jonathan has between 100 and 120 rock and dance songs, how many rock songs does he ha

4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’