ndawari120 ndawari120

Today at 3:08 PM
Biology

Answered

How are a cat, a fish, and a rose similar?

b) How are a cat, a fish, and a rose different?

Answer :

aryanputhran aryanputhran

Today at 3:14 PM

Answer:

A. They are all living, come in different colors.

B. They are all different species.

Answer Link

Other Questions

PLEASE HELP ASAP! Will give BRAINLIEST! Please answer correctly! No guessing!

During what stage of the cell cycle do sister chromatids line up in the middle ?

Please help meeee I’ll do anything

During what stage of the cell cycle do sister chromatids line up in the middle ?

PLEASE HELP ASAP! Will give BRAINLIEST! Please answer correctly! No guessing!

Tom ve jerry ingilizce karşılaştırma

If (x - 2) is a factor of (x - 1)^5 – (2x 3k)^2, then the value of k is?

DIARY WRITINGTEACHER'S DAYतमीज सीखो कोई सलूशन नंदकिशोर लिखे बताओ

India is the country inhabitate of poor

What sum of money earned rs 60 as simple interest in 3 year at the rate of 4%?

1-5 please help 25 points!!

Identify the property that justifies the following statement:

how many earth like planets are there

You roll a 6 sided number cube. Use the complement to determine the probability of not rolling a 4.

Read the poem below. Use the Close Reading and the Hint to help you answer the question. Cart Lyrk Poem The Heart of a Woman by Georgia Douglas Johnson Case Rea

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Traditional Maori histories are passed down through rather than in written form.

According to the Doppler effect, the sound of a police car siren is

Select the correct answer. If you lived under an economic systein in which the government controlled all aspects of production, which economic system would this

the story of pandora is just one of many myths that explain how evil came into the world. why do you think evil was something that came into the world later ins