jaidenlaine827 jaidenlaine827

Today at 6:44 PM
Biology

Answered

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule?
GTAAGCTTCGACAAGCTTGCTGA

Answer :

Other Questions

punctuate the given passage carefullyhave you ever played tape the tail on the donkey we played it at my birthday party it's easy fun first mom pasted. a big pi

10P0INTS What was Addam's overall thesis in chapter two of Twenty Years at Hull House? A.)Lincoln would not have been able to rebuild the South if he had not di

How to make foam please answer me

The process shown below when a cell surrounds a substance in the outside environment, enclosing the substance in a portion of the plasma membrane is called ?

punctuate the given passage carefullyhave you ever played tape the tail on the donkey we played it at my birthday party it's easy fun first mom pasted. a big pi

The combustion in a compression ignition engine is . a.heterogeneous b.homogeneous c.laminar d.turbulent

Express each of the following ratios in the simplest form 36:90

1. What is a word ?2. What is a phrase ?

hhcayzewuy 100% privacy What is the largest source of groundwater in the Indian peninsula?

Em relação ao gerenciamento do cuidado no câncer de mama, an

This modern dance troupe combines exciting choreography with rhythms created from everyday objects. It is one musical group famous for its use of found instrume

Compare these two images in terms of formal characteristics - how are they similar, how different? Then describe the context in which each was made. What does e

Big 40 cal. in my shirt no karate

the area of the playground is 1,728 square feet. the width is 54 feet. what is the length of the playground

what defines the mass number of an isotope

pleaseee helpppp will mark BRAINLIEST!!

If a teen drinks more than one 12-ounce soda every day, how high is their chance of becoming obese later in life? 1. more than 70% 2.more than 80% 3. as much as

Which of the following persuasive techniques does Mary Fisher use in her speech? presenting an appeal to pity reinforcing existing beliefs and laws shaping atti

How did monotheism affect the Jewish people?

Which strategies did the United States employ in order to achieve victory in the Pacific? Check all that apply. 1) guerrilla warfare 2) island-hopping 3) chemic