Ta9ysMoniaza6llme Ta9ysMoniaza6llme

Today at 5:03 AM
Health

Answered

Overcooking foods destroys: germs aroma nutritional value fats

Answer :

Today at 5:08 AM

Overlooking food destroys nutritional value.

Answer Link

Other Questions

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

The average age of a university student was found to be 24 with a standard deviation of 2. What age group is within 2 standard deviations of the mean?

The surface appearance of a material is called its O rock cycle O lava fracture luster

Target offers a discount if you spend at least $50. Write an inequality to represent d, how much you must spend to receive the discount.

Find area of rhombus whose diagonal area 8 and 14

There are 54 balls in first box and 179 balls in the second box. Estimate the total number of balls in both the boxes using the general rule.

· Discuss the religious and spiritual developments of the medieval period in detail.

a partice of mass m strikes elastically on a wall with velocity v , at an angle of 60° from the wall then magnitutude change in momentum of ball along the wall

What is mensuntral cycle??

How do the structures of the national political parties reflect the fundamental purpose of political parties

Please answer **ASAP** if an=n(an-1) and a1=1 what is the value of a5 a. 5 b. 20 c. 120 d. 720

URGENT: please help!!!!!!!!!

which animal does not live in the Thar desert

A square dining room table has a perimeter of (12x "-40)" feet.Which expression represents the side length of the table (in feet)

22. The term describes the removal of a body part or the destruction of its function through the use of surgery, hormones, drugs, heat, chemicals, electrocaute

150 people went to see "Ode to Algebra" performed in the school auditorium. If the number of children that attended the performance was c, how many adults atten

betsy correctly answered 19 of 25 trivia questions. What percent of the questions did she answer correctly?

3. How many groups 1/2 of days are in 1 week? groups

find the value of r so the line that passes through each pair of points has the given slope (5, 3), (r, -5), m=4