smartboy1999 smartboy1999

Today at 4:30 AM
English

Answered

From what you have observed, how important is the title of a short story? Explain your answer in three to five sentences including examples from the story the cold equations

Answer :

wsswswssws wsswswssws

Today at 4:34 AM

The cold equations is one of the most famous science fiction short story made by Tom Godwin. I think the other title that could fit in this story is this one, "The unwanted loving cargo" because its all about a girl that is on board on a ship where pilot, Baron would come to a decision in jettisoned the girl in the atmosphere so make the mission successful. helpful

Answer Link

Other Questions

HURRY!!!!!!!!!!!!!!!!!!!!! You spin the spinner. How likely is it that the spinner lands on a yellow or red space? A) certain B) likely C) unlikely D) impossibl

which is not a helpful way to track sources for a research paper? A) writing source information on photocopies and Internet printout B) using notes cards C)usin

QUICK!!!!!!!!!!!! QUICKKKK!!! HELP!!!! What is the slope of the line????

11. Evaluate: f(x) = x^2 - 2x + 1,

Frank left his house at 7 a.m. and drove to the airport at a speed of 50 mph. Lance left his house at 6 a.m. and drove to the same airport at a speed of 55 mph.

Different phses of bacterial decomposition

Divide 308 in three parts in the ratio 3/4:1/8:7/3 then 1st part:2nd part:3rd part is

represent these numbers on a single number line

what is 3RS?shal I asnwer

When was muslim league passed the resolution divide and quit movement?

What is the arrhythmia?

For the function f(x)=5x^2-7x, what is f(-3)? *

These are tru or clase questions 1) T or F A flood in a forest could cause trees in that ecosystem to die. 2) T or F Human activities can have a either positive

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

How can a piece of wood floating on water illustrate the condition of lowest potential energy and maximumstability?

How was the land politically divided in Ancient Greek civilization

4. Identify which of the following are oxidation-reduction reactions. If a reaction is a redox reaction, name the element oxidized and the element reduced. a. M

Important rock-and-roll artists in the 1970s and 1980s included which of the following? A. Elvis Presley B. Jimmy Dorsey C. Led Zeppelin D. None of the above

Which one is right because u need help

Square ABCD has a side length of 4 inches. The square is dilated by a scale factor of 4 to form square A'B'C'D'. How can you transform square A'B'C'D' back to s