tsjohnson tsjohnson

Today at 2:49 AM
Biology

Answered

when you drop a sugar cube in a glass of water, at first the water doesn't taste sweet. Later, it tastes very sweet. Is active or passive transport involved?

Answer :

Аноним Аноним

Today at 2:54 AM

Yes it is involved! Good luck!

Answer Link

GoldScarab GoldScarab

Today at 2:54 AM

Passive transport because the sugar molecules move slowly through the water.

Answer Link

Other Questions

Determine the volume at the equivalence point if a 0.100 M NaOH(aq) solution is used to titrate the following acidic solutions: (a) 30.0 mL of 0.600 M HClO4(aq)

When overriding a superclass method and calling the superclass version from the subclass method, failure to prefix the superclass method name with the keyword s

The specialty of an athlete on the women's track team is the pole vault. She has a mass of 60.0 kg and her approach speed is 9.20 m/s. When she is directly abov

When overriding a superclass method and calling the superclass version from the subclass method, failure to prefix the superclass method name with the keyword s

Consider the substitution reaction that rakes place when (R)-3-bromo 3-methylhexane is treated with methanol. Which of the following would be true? The reaction

रिगर संज्ञा शब्दों के लिए दो-दो विशेषण शब्द लिखिए-विशषणHINDI1. संतरा2 तितली5. कोयल6. बादल7. कपड़ेमित्र ladka

Two different approaches, each seems to be valid, yield diff

परचनात्मककायमअमित्र एकादश-कक्षायां संस्कृत पठितु प्रेरयितु लिखिते पत्रे रिक्तस्थानानि पूरयित्वा पत्रं च पुनःतरपुस्तिकायो लिखतु । (चिन्तनात्मकः प्रश्नः)छात्रावास

Priyanka said "Alas! I am ruined"

of4. A material that allows electric current toflow through it is theelectricity.5. A material through which electric currentdoes not flow is theofelectricity.1

Explanation. Please Help!!!

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

Solve the following system of equations: x – 3y = 18 9x – 2y = 12

On Earth, a brick has a mass of 10 kg and a weight of 5 lbs. What predictions could we make about the mass and weight of the brick on the Moon, where there is l

b.Being deoxygenated in the alveoli c.Being oxygenated in body tissues d.Being deoxygenated in body tissuesCarbon monoxide prevents oxygen from binding to hemo

Which is most important for a city to know before building a bike path next to a busy road

write down a simplified expression for the perimeter of this triangle:

Which crops and products were part of the ancient Roman economy?

During the final years of World War II, how did the Allies gain control of the Atlantic Ocean?

ANSWER TO BE NAMED BRAINLIEST AND GET 25 PTS AND GET A THANK U plz help ASAP What is the value of Q3 of the data represented by the box plot? Enter your answer