emij5oimsjos4sosweet emij5oimsjos4sosweet

Today at 7:46 PM
Business

Answered

Does a real-world market have to meet all the assumptions of the theory of perfect competition before it is considered a perfectly competitive market?

Answer :

bigDtaylor00 bigDtaylor00

Today at 7:50 PM

No, probably no real-world market meets all the assumptions of the theory of perfect competition. All that is necessary is that a real world market behave as if it satisfies all the assumptions

Answer Link

Other Questions

parson says “We wish to get at it by degrees.” Does this statement make him seem more radical or more moderate?

Would the image be categorized as a function or as a relation? Use at least one sentence to explain your answer.

2(3x - 1) + 2(4x + 5) = 8

parson says “We wish to get at it by degrees.” Does this statement make him seem more radical or more moderate?

Jabari is power washing houses for a summer job. For every job, he charges an initial fee plus a $30 sign, 30 for each hour of work. His total fee for a 4-hour

The combustion in a compression ignition engine is . a.heterogeneous b.homogeneous c.laminar d.turbulent

Express each of the following ratios in the simplest form 36:90

1. What is a word ?2. What is a phrase ?

hhcayzewuy 100% privacy What is the largest source of groundwater in the Indian peninsula?

Em relação ao gerenciamento do cuidado no câncer de mama, an

Given f(x ) = 3x − 1 and (f ∘ g)(x ) = x , find g(x ) Please Help I need to answer this question

After Elizabeth's father died, what did Elizabeth ask her mother to do?

Calculate the mean, median, and mode of the following set of data. round to the nearest tenth. 11, 9, 7, 6, 8, 2, 15, 1, 12, 15, 14mean: 11 + 9 + 7 + 6 + 8 + 2

How did the "old way" of gaining knowledge change with the Scientific Revolution? Address specific people such as Copernicus, Galileo, Bacon, Descartes, etc. in

Factorise this expression 5x2+15x+10

Batman's age is 12 less than triple Robin's age. When you add Batman's age to Robin's age, you get 68. How old is Batman and how old is ...

x-intercept = and y-intercept = 4

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

3 different types of substance that may preserve an entire organism.

Aisha borrows #18500 at 6 compound Interest,She pays back #45,000 at the end of each year.How much does she still owes after she has made her second repayment.