hollie6
hollie6
Today at 4:31 PM
Mathematics
Answered
Match each inequality with its solution set
Answer :
bcalle
bcalle
Today at 4:36 PM
5x + 7 > = 17
2x + 1 < = 3
1 + 3x > = -5
5 -3x > = 11
Answer Link
VIEW ALL ANSWERS ( 59+ )
Other Questions
A field is to be fertilized at a cost of $0.08 per square yard. the rectangular part of the field is 95 yd long and the diameter of each semicircle is 49 yd. Fi
about how many americans served in the armed forces during world war 2
A field is to be fertilized at a cost of $0.08 per square yard. the rectangular part of the field is 95 yd long and the diameter of each semicircle is 49 yd. Fi
What is the action force responsible for seafloor spreading?
What is the first step in setting up a new fitness plan?
5 ______ has appointed ICICI Bank as an agent for the conduc
Sudheer land rupees 2008 company straight at 10% per year live prasaran land rupees 2000 compound interest and 10% table half yearly find the difference in the
SmartACTOLOIANCED ISTIS ICSHAND SANITIZESPRAYALL 99.9%PROTECT
Which person was considered to be the greatest physician in
बहन से अच्छा दोस्त और कोई नहीं हो सकता,और मेरी बहना !तुमसे अच्छी कोई और बहन हो ही नहीं सकती ❤️ … ।। didi. ❤️[tex] \\ \\ \\ \\ [/tex]
When describing the functions of the ANS, which of the following would the instructor include? Maintenance of balance and posture Regulation of integrated inter
You want the current amplitude through a 0.450-mH inductor (part of the circuitry for a radio receiver) to be 1.80 mA when a sinusoidal voltage with amplitude 1
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade
All are examples of powers held by the states EXCEPT: a establish local governments b conduct foreign relations c ratify the amendments to the federal Constitut
Choose the correct sentence. a. I am asking if you would like to rollerblade together tomorrow? b. I am asking "if you would like to rollerblade together tomorr
Independent regulatory agencies such as the Federal Trade Commission are. a. not part of the government's executive branch. b. outside the major departments of
Which of the following is true? a. Yeast, nematodes and brine shrimp use the same means to survive desiccation. b. Tardigrades, nematodes, and brine shrimp use
which quantity is use to generate the error bars on a graph?
What information are you looking for when you assess a guest? A. Personality traits and intoxication rate factors B. Behavioral cues and intoxication rate facto
At a certain temperature, the Kp for the decomposition of H2S is 0.795. H2S (g) ------> H2(g) + S(g) Initially, only H2S is present at a pressure of 0.203 atm i
