frannymolfino4000 frannymolfino4000

Today at 3:24 AM
Social Studies

Answered

___________ is not a component of hearing.
a.Attempting to recall
b.Making an effort to attend
c.Providing feedback
d.all of the above

Answer :

Other Questions

Describe how you created the 0.075 M glucose solution from the 1 M stock solution. Show your calculations and give details about the equipment used, which solut

A corporation reports the following year-end balance sheet data. The company's acid-test ratio equals:Cash $ 41,000 Current liabilities $ 76,000 Accounts receiv

Cuneiform was used in .

What is the change in internal energy of an engine if you put 15 gallon of gasoline into its tank? The energy content of gasoline is 1.5 x 106 J/gallon. All oth

Solve the equation for x. x - 3.1 = -2.1 a. 1 b. -1 c. -1.1 d. 1.1

Write if the set is empty, unit, infinite and finite. {Raindrops}

mesolethic age is also called stone age

Meanings and Explanations(1) When I consider how my light is spentEre half my days, ir this dark world and wide,And that one talent, which is death to hide,Lodg

3. String index values are also called as (a) class (b) function (c) subscript (d) arguments

there are decline in poverty in sub-states significance

Help Quickly!! Look up information on Ash Wednesday, Lent, and Carnival. Write a paragraph on each, telling how these special times are related. Your report sho

The cooking club made some pies to sell at a basketball game to raise money for the new books. The cafeteria contributed four pies to the sale. Each pie was the

-4(4-3p) help me with this question

Solve for x 4x−2=3x+4

Which of the following is known as an American military hero? O A) Daniel Boone OB) William Pitt C General Braddock OD) George Washington

Domain and range of T

Jonas is planning out his route for an upcoming race. He uses negative numbers to represent points beforethe finish line and positive numbers to represent point

A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA…

Filling your individualf ederal tax returns would be best described what type of value chain?

A small square loop carries the current 32A. the on axis magnetic field strength 50 cm for the loop is 4.9 nT. What is the edge length of the square?